Contact Us

  T3/Wheat

Marker IWA610

Marker name IWA610
Updated on 2018-01-30 19:46:05
A allele T
B allele C
Sequence

TGAGAAATAATGCAAGCCTAGGTAGTATTGGTAGCCAAACAAAACTTAGAATTTCAAGGA[C/T]TCAACGGAAGCTTAG
GGGGAGTGTTATATATTCAATATGTGATTAAAAARGGGAAATAAT

Marker Types

Marker Type Name
SNP View

Annotations

DatasetEntryDataset Description
Ensembl Browser3B:495262165-495262265IWGSC1+popseq, Nov 2014
EnsemblPlants GeneTRIAE_CS42_3B_TGACv1_220628_AA0712740TGACv1, Ensembl Plants release 35
NCBI ESTBQ159467
T3 JBrowse3B:495262165..495262265IWGSC1+popseq, Nov 2014
URGI GBrowse3B_10401664GBrowse of BLAST match URGI Assembly July 2013

Marker Synonyms

ValueName
wsnp_BQ159467B_Ta_2_1 EST Name View
IWA610 TCAP Code View

Allele Information

Line Data: Show alleles for all lines

Map locations

MapChromosomeStartEndBin
wsnp2013_3B3B142.46142.46
90K_cons2014_3B3B68.7098653268.70986532
popseq2014_3B3B67.4867.48
RefSeq_3B3B500541347500541347
css2014_3B3B495262215495262215
TGACv1_3B3B391011391011TGACv1_scaffold_220628_3B
pan_3B_traes3bPseudomoleculeV13B_traes3bPseudomoleculeV1497097331497097331

Selection List

In 2009 the Toronto International Data Release Workshop agreed on a policy statement about prepublication data sharing. Accordingly, the data producers are making many of the datasets in T3 available prior to publication of a global analysis. Guidelines for appropriate sharing of these data are given in the excerpt from the Toronto Statement.

I agree to the Data Usage Policy as specified in Toronto Statement.