Contact Us

  T3/Wheat

Marker IWA6086

Marker name IWA6086
Updated on 2018-01-30 19:53:02
A allele T
B allele C
Sequence

TTTGAAACTTGGAAGTATGTCCCTACAGTTGCCTGTTATGTGTTATGCCAACCTATTTCTATTTTTGTGACACGTCTCTC
ACTCTCTACCCCTCCACACA[C/T]CAAGTCAATTTATATGATAAGATTTTGAACTCTTTGAACACAGTATARAKGCAAA
CGAGCTTACTCACCCCATGAATGAGCATCTAAAG

Marker Types

Marker Type Name
SNP View

Annotations

DatasetEntryDataset Description
EnsemblPlants GeneTRIAE_CS42_3B_TGACv1_225008_AA0804050TGACv1, Ensembl Plants release 35

Marker Synonyms

ValueName
wsnp_JD_c5067_6187376 EST Name View
IWA6086 TCAP Code View

Allele Information

Line Data: Show alleles for all lines

Map locations

MapChromosomeStartEndBin
wsnp2013_3B3B139.6139.6
90K_cons2014_3B3B66.7820885366.78208853
popseq2014_3B3B68.29568.295
RefSeq_3B3B486379255486379255
css2014_3B3B486038517486038517
TGACv1_3B3B97529752TGACv1_scaffold_225008_3B
pan_3B_traes3bPseudomoleculeV13B_traes3bPseudomoleculeV1487818272487818272

Selection List

In 2009 the Toronto International Data Release Workshop agreed on a policy statement about prepublication data sharing. Accordingly, the data producers are making many of the datasets in T3 available prior to publication of a global analysis. Guidelines for appropriate sharing of these data are given in the excerpt from the Toronto Statement.

I agree to the Data Usage Policy as specified in Toronto Statement.