Contact Us

  T3/Wheat

Marker IWA537

Marker name IWA537
Updated on 2018-01-30 19:45:59
A allele A
B allele G
Sequence

ACTCCAAATGACTGAGTCAAAATCCGTGCCATAGGTGTGGCAATAGTATGGGTACCCTTG[A/G]TAACGAAATTTCAAC
ATAATTTTGAAACAGACACCAAGAACCATCTTGGGTTTCAACTGT

Marker Types

Marker Type Name
SNP View

Annotations

DatasetEntryDataset Description
NCBI ESTBG263758NCBI nucleotide database from GenBank
T3 JBrowsechr3B:498064254RefSeq v1, release March 2019

Marker Synonyms

ValueName
wsnp_BG263758B_Ta_2_1 EST Name View
IWA537 TCAP Code View

Allele Information

Line Data: Show alleles for all lines

Map locations

MapChromosomeStartEndBin
KPxKC_SNP2012_3B3B59.759.7
wsnp2013_3B3B141.85141.85
90K_cons2014_3B3B68.7098653268.70986532
popseq2014_3B3B67.4867.48
RefSeq_3B3B498064254498064254
pan_3B_traes3bPseudomoleculeV13B_traes3bPseudomoleculeV1501260997501260997

Selection List

In 2009 the Toronto International Data Release Workshop agreed on a policy statement about prepublication data sharing. Accordingly, the data producers are making many of the datasets in T3 available prior to publication of a global analysis. Guidelines for appropriate sharing of these data are given in the excerpt from the Toronto Statement.

I agree to the Data Usage Policy as specified in Toronto Statement.