Contact Us

  T3/Wheat

Marker IWA4613

Marker name IWA4613
Updated on 2018-01-30 19:51:07
A allele A
B allele G
Sequence

AATGTTTCTGGTCTGGAATCGCTGGACGGAAGCATTGTTAGCGAGATGGAAGGTGAGAGCACCATCGACCGGCTGAGACG
ACAGATTGATCTAGACCGGA[A/G]GTCGATACACCTCCTCTGCAGGGAGCTGGAAGAAGAGAGGAACGCCGCGGCGATC
GCTGCAAACCAAGCACTGGCCATGATCACCAGGCTGCAGGATGAG

Marker Types

Marker Type Name
SNP View

Annotations

DatasetEntryDataset Description
T3 JBrowsechr3B:552230681RefSeq v1, release March 2019

Marker Synonyms

ValueName
wsnp_Ex_c7021_12096881 EST Name View
IWA4613 TCAP Code View
TaRefSeqv1_3B552230681C/T Uniform marker name View

Allele Information

Line Data: Show alleles for all lines

Map locations

MapChromosomeStartEndBin
popseq2014_3B3B74.61574.615
RefSeq_3B3B552230681552230681
pan_3B_traes3bPseudomoleculeV13B_traes3bPseudomoleculeV1543124927543124927

Selection List

In 2009 the Toronto International Data Release Workshop agreed on a policy statement about prepublication data sharing. Accordingly, the data producers are making many of the datasets in T3 available prior to publication of a global analysis. Guidelines for appropriate sharing of these data are given in the excerpt from the Toronto Statement

I agree to the Data Usage Policy as specified in Toronto Statement.