Contact Us

  T3/Wheat

BLAST Analysis

BLAST Analysis

The BLAST page allows you to view the blast hits in JBrowse. Previously you were given the coordinates and you would have to find the JBrowse with the correct reference assembly and manually copy the coordinates.
The available BLAST database and access restrictions are described below and on the Database(s) link on the BLAST page.

DatabaseUseResults Link
Wheat Markers in T3 find T3 markers that match query sequence Marker Report page in T3
Wheat TGACv1 view genome aligned to Ensembl Plant Ensembl Plant
Wheat Pangenome view genome aligned to Wheat Pangenome GBrowse
RefSeq_v1 (login required) view genome aligned to RefSeq_v1 T3 JBrowse and URGI JBrowse (login required)

Example:
  1. Register on T3 Wheat as a Project Participant.
  2. Login to T3 Wheat.
  3. Past in the sequence of
    >AGACGGTGCCCTAGACCCTGTTGTATCCCACGTTTTTACTGAACAGGCGGCGGATGTAAACGACTTGCAACGCACTGGCGGCCATGAAAGCCGCGTACTCT
  4. Select the RefSeq_v1 database
  5. Select Basic search
  6. On the BLAST results page select chr5A under the T3 JBrowse column
  7. The BlastHSP Results track show you the BLAST match
  8. The Variations in T3 track shows you nearby markers
  9. The gene model HC track shows high confidence gene predictions