Contact Us

  T3/Oat

Marker avgbs2_98939.1.36

Marker name avgbs2_98939.1.36
Updated on 2016-02-18 09:18:59
A allele C
B allele T
Sequence

TGCAGCGTTGGTTCCTGCCGTCGCTCGCCCTCTAC[C/T]GCTGCTCGTCGCTCTCCTCCCTGGCTCT

Marker Types

Marker Type Name
GBS View

Annotations

DatasetEntryDataset Description
Haplotag Feb 2016avgbs2_98939POGI 2015 passport file, Agri-Food Canada

Allele Information

Line Data: Show alleles for all lines

Map locations

MapChromosomeStartEndBin
pepsico_4D4D1938687419386874

Selection List

In 2009 the Toronto International Data Release Workshop agreed on a policy statement about prepublication data sharing. Accordingly, the data producers are making many of the datasets in T3 available prior to publication of a global analysis. Guidelines for appropriate sharing of these data are given in the excerpt from the Toronto Statement

I agree to the Data Usage Policy as specified in Toronto Statement.