Contact Us

  T3/Oat

Marker avgbs2_98867.1.52

Marker name avgbs2_98867.1.52
Updated on 2016-02-18 09:18:59
A allele G
B allele T
Sequence

TGCAGCGTCGGCACCTCCCTACGTCCTCCCCCACGGGCACCTCGGTAGGTC[G/T]TCGTCGCCAGCA

Marker Types

Marker Type Name
GBS View

Annotations

DatasetEntryDataset Description
Haplotag Feb 2016avgbs2_98867POGI 2015 passport file, Agri-Food Canada

Allele Information

Line Data: Show alleles for all lines

Map locations

MapChromosomeStartEndBin
pepsico_4C4C9359921593599215

Selection List

In 2009 the Toronto International Data Release Workshop agreed on a policy statement about prepublication data sharing. Accordingly, the data producers are making many of the datasets in T3 available prior to publication of a global analysis. Guidelines for appropriate sharing of these data are given in the excerpt from the Toronto Statement

I agree to the Data Usage Policy as specified in Toronto Statement.