Contact Us

  T3/Oat

Marker avgbs2_98782.1.12

Marker name avgbs2_98782.1.12
Updated on 2016-02-18 09:18:59
A allele C
B allele G
Sequence

TGCAGCGTCGC[C/G]TCCTCGCTGCCTCGCTCAGGYCCGAGATCGGAAGAGCGGTTCAGCAGGAATG

Marker Types

Marker Type Name
GBS View

Annotations

DatasetEntryDataset Description
Haplotag Feb 2016avgbs2_98782POGI 2015 passport file, Agri-Food Canada

Allele Information

Line Data: Show alleles for all lines

In 2009 the Toronto International Data Release Workshop agreed on a policy statement about prepublication data sharing. Accordingly, the data producers are making many of the datasets in T3 available prior to publication of a global analysis. Guidelines for appropriate sharing of these data are given in the excerpt from the Toronto Statement

I agree to the Data Usage Policy as specified in Toronto Statement.