Marker SCRI_RS_108473
| Marker name | SCRI_RS_108473 |
| Updated on | 2015-07-16 13:22:02 |
| A allele | A |
| B allele | C |
| Sequence |
AGTTTGAATGGGACCATGCATGTTGTGGATGATCTGAGCAACCTTAGCATGAGGTAAATG[A/C]GCCAACTAGTTGCTG
CCTGGTTACAGCTGGAACAGAAACATATTTGGAACTGGAGCCAGT
|
Marker Types
| Marker Type Name | |
|---|---|
| SNP | View |
Annotations
| Dataset | Entry | Dataset Description |
|---|---|---|
| Barleymap | i_SCRI_RS_108473 | Position on the genome, with nearby genes |
| Ensembl | 3:351092176-351092296 | Genome browser of BLAST match IBSC Aug 2014 |
| Triticeae Toolbox | 3:351092176..351092296 | JBrowse of BLAST match IBSC Aug 2014 |
Allele Information
| Line Data: | Show alleles for all lines |
Map locations
| Map | Chromosome | Start | End | Bin |
|---|---|---|---|---|
| Barley2012SNP_3H | 3H | 51.6 | 51.6 | |
| AllSNPs2013_3H | 3H | 58.31 | 58.31 | |
| iSelect2013_3H | 3H | 58.31 | 58.31 | |
| Morex2012_3 | 3 | 351092236 | 351092236 | |
| Morex_2016_3H | 3H | 403670640 | 403670640 | |
| barley50k_3H | 3H | 403670640 | 403670640 |