Contact Us

  T3/Barley

Marker SCRI_RS_108473

Marker name SCRI_RS_108473
Updated on 2015-07-16 13:22:02
A allele A
B allele C
Sequence

AGTTTGAATGGGACCATGCATGTTGTGGATGATCTGAGCAACCTTAGCATGAGGTAAATG[A/C]GCCAACTAGTTGCTG
CCTGGTTACAGCTGGAACAGAAACATATTTGGAACTGGAGCCAGT

Marker Types

Marker Type Name
SNP View

Annotations

DatasetEntryDataset Description
Barleymapi_SCRI_RS_108473Position on the genome, with nearby genes
Ensembl3:351092176-351092296Genome browser of BLAST match IBSC Aug 2014
Triticeae Toolbox3:351092176..351092296JBrowse of BLAST match IBSC Aug 2014

Allele Information

Line Data: Show alleles for all lines

Map locations

MapChromosomeStartEndBin
Barley2012SNP_3H3H51.651.6
AllSNPs2013_3H3H58.3158.31
iSelect2013_3H3H58.3158.31
Morex2012_33351092236351092236
Morex_2016_3H3H403670640403670640
barley50k_3H3H403670640403670640

Selection List

In 2009 the Toronto International Data Release Workshop agreed on a policy statement about prepublication data sharing. Accordingly, the data producers are making many of the datasets in T3 available prior to publication of a global analysis. Guidelines for appropriate sharing of these data are given in the excerpt from the Toronto Statement

I agree to the Data Usage Policy as specified in Toronto Statement.