Contact Us

  T3/Barley

Marker 12_20721

Marker name 12_20721
Updated on 2015-07-17 19:31:15
A allele A
B allele C
Sequence

GCATGCAGGATGACAACTGCAACAAAAAGAACCACCAGGCAACAAATTCAAGATCGGCTT[A/C]GACAAAATAATCGTA
ACATCCTGTTGCTGCCAAGCAACAAACCATGGCCAAGCCTCATTG

Marker Types

Marker Type Name
OPA SNP Name View

Annotations

DatasetEntryDataset Description
Barleymapi_12_20721Position on the genome, with nearby genes
Ensembl3:351092506-351092626Genome browser of BLAST match IBSC Aug 2014
GrainGenesPOPA2_0721
Harvest BACHVVMRXALLhA0374M17BAC containing the marker
Harvest BACHVVMRXALLhA0453J06BAC containing the marker
HARVEST_U324261Close Lab: HarvEST Assembly 32 Unigene Number
HARVEST_U3516376Close Lab: HarvEST Assembly 35 Unigene number
Triticeae Toolbox3:351092506..351092626JBrowse of BLAST match IBSC Aug 2014
U35_PROBE_SETContig5894_s_atClose Lab, HarvEST Assembly 35, at least 5 matches
U35_RICE_DESCRIPTIONprotein NMDA receptor-regulated 1-like protein, putative, expressedClose Lab, using HarvEST Barley Assembly 35

Marker Synonyms

ValueName
12_20721 BOPA Combined Name View
12_0492 BOPA Name View
4261-3175 EST Name View
2_0721 POPA Name View
BOPA2_12_20721 BOPA Combined Name View

Allele Information

Line Data: Show alleles for all lines

Map locations

MapChromosomeStartEndBin
UCR_3H3H56.456.4
OWB_3H3H62.95162.951
OPA2011_3H3H67.2767.27
Barley2012SNP_UU00
AllSNPs2013_3H3H58.3158.31
iSelect2013_3H3H58.3158.31
Morex2012_33351092566351092566
Morex_2016_3H3H403670310403670310

Selection List

In 2009 the Toronto International Data Release Workshop agreed on a policy statement about prepublication data sharing. Accordingly, the data producers are making many of the datasets in T3 available prior to publication of a global analysis. Guidelines for appropriate sharing of these data are given in the excerpt from the Toronto Statement

I agree to the Data Usage Policy as specified in Toronto Statement.