Contact Us

  T3/Barley

Marker owbGBS28947

Marker name owbGBS28947
Updated on 2015-07-16 13:22:20
A allele C
B allele T
Sequence

TGCAGGGCCGACCCTAGGGCGAGCTTGA[C/T]GACATGGGCCCTAAGTCCTCAAACCATATATATG

Marker Types

Marker Type Name
GBS View

Annotations

DatasetEntryDataset Description
BarleymapowbGBS28947Position on the genome, with nearby genes
Ensembl3:351093199-351093261Genome browser of BLAST match IBSC Aug 2014
Triticeae Toolbox3:351093199..351093261JBrowse of BLAST match IBSC Aug 2014

Allele Information

Line Data: Show alleles for all lines

Map locations

MapChromosomeStartEndBin
OWB_GBS_3H3H4951owbGBS_3H_Bin49-51
Morex2012_33351093227351093227
Morex_2016_3H3H403669643403669643

Selection List

In 2009 the Toronto International Data Release Workshop agreed on a policy statement about prepublication data sharing. Accordingly, the data producers are making many of the datasets in T3 available prior to publication of a global analysis. Guidelines for appropriate sharing of these data are given in the excerpt from the Toronto Statement

I agree to the Data Usage Policy as specified in Toronto Statement.